Stem-loop sequence bta-mir-12037

AccessionMI0038458 (change log)
DescriptionBos taurus miR-12037 stem-loop
Stem-loop
   --         a       uc  uu   auuau 
5'   ugaagagaa auagaau  ca  guu     u
     ||||||||| |||||||  ||  |||     c
3'   auuucucuu ugucuua  gu  uaa     a
   ug         c       -c  uc   aacca 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr17: 9827497-9827562 [+]
intergenic
Database links

Mature sequence bta-miR-12037

Accession MIMAT0046732
Sequence

47 - 

cauucugucuucucuuuagu

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).