Stem-loop sequence bta-mir-12036

AccessionMI0038457 (change log)
DescriptionBos taurus miR-12036 stem-loop
Stem-loop
   --c         acu      u     cc   u 
5'    ggcuccgug   cguccg ggacg  ggu c
      |||||||||   |||||| |||||  |||  
3'    ccgaggcgc   gcgggc ccugc  ccg g
   acu         --c      -     -c   a 
Get sequence
Deep sequencing
46 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr17: 34865979-34866040 [-]
intergenic
Database links

Mature sequence bta-miR-12036

Accession MIMAT0046731
Sequence

1 - 

cggcuccgugacucguccguggac

 - 24

Get sequence
Deep sequencing20 reads, 14 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).