Stem-loop sequence bta-mir-12033

AccessionMI0038452 (change log)
DescriptionBos taurus miR-12033 stem-loop
Stem-loop
   --ug                         uaua 
5'     cccugggaguguaaauauuggcacc    c
       |||||||||||||||||||||||||    c
3'     gggacucuuacauuuguaaccgugg    a
   gagg                         uucc 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr23: 29003567-29003633 [-]
intergenic
Database links

Mature sequence bta-miR-12033

Accession MIMAT0046726
Sequence

1 - 

ugcccugggaguguaaauauugg

 - 23

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).