Stem-loop sequence bta-mir-12032

AccessionMI0038451 (change log)
DescriptionBos taurus miR-12032 stem-loop
Stem-loop
   --u ug        aa       a  gaa 
5'    c  gccuggag  gcccugg gu   a
      |  ||||||||  ||||||| ||    
3'    g  cggaucuc  ugggacc cg   a
   ggu gu        cg       -  gac 
Get sequence
Deep sequencing
21 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr20: 2290230-2290286 [+]
intergenic
Database links

Mature sequence bta-miR-12032

Accession MIMAT0046725
Sequence

1 - 

ucuggccuggagaagcccugg

 - 21

Get sequence
Deep sequencing21 reads, 14 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).