Stem-loop sequence bta-mir-12031

AccessionMI0038450 (change log)
DescriptionBos taurus miR-12031 stem-loop
Stem-loop
   --          aa  c         uauccaa 
5'   uucuguagau  gc ccaguuaca       u
     ||||||||||  || |||||||||        
3'   aagacgucug  cg gguuaaugu       u
   cg          ac  a         cuauaca 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr10: 19395552-19395617 [+]
intergenic
Database links

Mature sequence bta-miR-12031

Accession MIMAT0046724
Sequence

45 - 

auuggagccagucugcagaagc

 - 66

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).