Stem-loop sequence bta-mir-12028

AccessionMI0038447 (change log)
DescriptionBos taurus miR-12028 stem-loop
Stem-loop
   ---agc      ---    g   u  -ga       
5'       ucgggg   caga guc gu   ccugca 
         ||||||   |||| ||| ||   ||||| g
3'       agcccc   gucu uag ca   ggacgg 
   ucucuu      agg    g   u  aga       
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 45124056-45124119 [+]
intergenic
Database links

Mature sequence bta-miR-12028

Accession MIMAT0046721
Sequence

44 - 

ugucugggaccccgauucucu

 - 64

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).