Stem-loop sequence bta-mir-12026-2

AccessionMI0038445 (change log)
DescriptionBos taurus miR-12026-2 stem-loop
Stem-loop
   --    a      ---    u  c 
5'   uggc cagcag   cugg gc u
     |||| ||||||   |||| ||  
3'   accg gucguc   ggcc cg c
   gg    -      agg    -  g 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bta-miR-12026

Accession MIMAT0046719
Sequence

24 - 

cccggggacugcuggccagg

 - 43

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).