Stem-loop sequence bta-mir-12025

AccessionMI0038443 (change log)
DescriptionBos taurus miR-12025 stem-loop
Stem-loop
   --g       -uuc         g   agg 
5'    ccucugc    ccccgcggc ccu   g
      |||||||    ||||||||| |||    
3'    ggagacg    ggggcgcug gga   a
   uca       uuuu         g   ggg 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67097984-67098042 [+]
intergenic
Database links

Mature sequence bta-miR-12025

Accession MIMAT0046718
Sequence

38 - 

ucgcgggguuuugcagaggacu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).