Stem-loop sequence bta-mir-12021

AccessionMI0038439 (change log)
DescriptionBos taurus miR-12021 stem-loop
Stem-loop
   -a                ugaagu       
5'   cuggcagguuuuucuc      gacagg 
     ||||||||||||||||      ||||| u
3'   gaccgucuaaaaagag      uugucu 
   uc                ---uuu       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 60534145-60534201 [+]
intergenic
Database links

Mature sequence bta-miR-12021

Accession MIMAT0046714
Sequence

38 - 

uugagaaaaaucugccagcu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).