Stem-loop sequence bta-mir-12018

AccessionMI0038426 (change log)
DescriptionBos taurus miR-12018 stem-loop
Stem-loop
   --        ga   a   -      cu  a 
5'   aagacauu  ucg aca gauccu  gc a
     ||||||||  ||| ||| ||||||  ||  
3'   uucuguaa  agc ugu cuaggg  cg g
   ag        -g   c   u      --  g 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 24295539-24295596 [+]
intergenic
Database links

Mature sequence bta-miR-12018

Accession MIMAT0046701
Sequence

37 - 

aucuuguccgagaaugucuuga

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).