Stem-loop sequence bta-mir-12017

AccessionMI0038422 (change log)
DescriptionBos taurus miR-12017 stem-loop
Stem-loop
   aca  gg     uu          -  ucu 
5'    ga  agcuu  gacaugaacu ga   u
      ||  |||||  |||||||||| ||   u
3'    cu  ucgag  cuguacuuga cu   a
   aga  aa     -u          a  uac 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr24: 54905569-54905629 [-]
intergenic
Database links

Mature sequence bta-miR-12017

Accession MIMAT0046697
Sequence

1 - 

acagaggagcuuuugacaugaac

 - 23

Get sequence
Deep sequencing10 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).