Stem-loop sequence bta-mir-12002b

AccessionMI0038419 (change log)
DescriptionBos taurus miR-12002b stem-loop
Stem-loop
   -a                cu     a aaag 
5'   cuaaagauuccacaug  gugca c    u
     ||||||||||||||||  ||||| |    g
3'   gauuucuaagguguac  caugu g    a
   uc                uc     a acua 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 100867186-100867249 [+]
intergenic
Database links

Mature sequence bta-miR-12002b

Accession MIMAT0046694
Sequence

44 - 

ccucauguggaaucuuuagcu

 - 64

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).