Stem-loop sequence bta-mir-12015

AccessionMI0038415 (change log)
DescriptionBos taurus miR-12015 stem-loop
Stem-loop
   --      u ug   u     --g  g 
5'   cugccc g  ggg ccugc   cu g
     |||||| |  ||| |||||   ||  
3'   ggcggg c  ccc ggacg   gg a
   ga      c gu   u     aca  a 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr20: 71638862-71638913 [+]
intergenic
Database links

Mature sequence bta-miR-12015

Accession MIMAT0046690
Sequence

33 - 

caggucccugccgggcggag

 - 52

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).