Stem-loop sequence bta-mir-12014

AccessionMI0038414 (change log)
DescriptionBos taurus miR-12014 stem-loop
Stem-loop
   ---         a    ag     -a  u 
5'    cagggccca gccc  ggcag  gg g
      ||||||||| ||||  |||||  || c
3'    guuccgggu cggg  ccguc  uc a
   agg         -    ca     cg  g 
Get sequence
Deep sequencing
20 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 106159044-106159099 [+]
intergenic
Database links

Mature sequence bta-miR-12014

Accession MIMAT0046689
Sequence

35 - 

ugccacgggcugggccuuggga

 - 56

Get sequence
Deep sequencing19 reads, 14 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).