Stem-loop sequence bta-mir-6501

AccessionMI0038410 (change log)
DescriptionBos taurus miR-6501 stem-loop
Stem-loop
   --a       -         gca ug  aacag 
5'    guugcca gggcugccu   g  ac     c
      ||||||| |||||||||   |  ||      
3'    caauggu uccgacggg   c  ug     a
   uga       g         -ac gu  agaug 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 1256977-1257040 [-]
intergenic
Database links

Mature sequence bta-miR-6501

Accession MIMAT0046685
Sequence

42 - 

ccagggcagccugugguaacagu

 - 64

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).