Stem-loop sequence bta-mir-12013

AccessionMI0038409 (change log)
DescriptionBos taurus miR-12013 stem-loop
Stem-loop
   --   -                    a ga  u 
5'   ccc gaguuugggcagcaguucag g  ca u
     ||| |||||||||||||||||||| |  ||  
3'   ggg cucaaauccgucgucaaguu c  gu g
   uc   a                    a aa  c 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 102775008-102775072 [-]
intergenic
Database links

Mature sequence bta-miR-12013

Accession MIMAT0046684
Sequence

1 - 

cccgaguuugggcagcaguuca

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).