Stem-loop sequence bta-mir-12012

AccessionMI0038405 (change log)
DescriptionBos taurus miR-12012 stem-loop
Stem-loop
   gu          u        a  a 
5'   gcucuagagc cacaggcc cg c
     |||||||||| |||||||| || u
3'   ugagaucucg guguccgg gu a
   uc          u        -  c 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 74208977-74209028 [+]
intergenic
Database links

Mature sequence bta-miR-12012

Accession MIMAT0046680
Sequence

1 - 

gugcucuagagcucacaggcc

 - 21

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).