Stem-loop sequence bta-mir-12011

AccessionMI0038404 (change log)
DescriptionBos taurus miR-12011 stem-loop
Stem-loop
   ---   a       -      aa     cca 
5'    gag gcccaug agacuc  acagg   u
      ||| ||||||| ||||||  |||||   c
3'    cuc cggguac ucuggg  ugucc   c
   ccc   -       c      -g     uuc 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 30001042-30001100 [+]
intergenic
Database links

Mature sequence bta-miR-12011

Accession MIMAT0046679
Sequence

1 - 

gagagcccaugagacucaaaca

 - 22

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).