Stem-loop sequence bta-mir-12009

AccessionMI0038402 (change log)
DescriptionBos taurus miR-12009 stem-loop
Stem-loop
   a                         c  u 
5'  acaagcaaguucccuccacuuaaaa ag u
    ||||||||||||||||||||||||| ||  
3'  uguucguucaagggaggugaguuuu uc u
   -                         -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr23: 16453839-16453898 [+]
intergenic
Database links

Mature sequence bta-miR-12009

Accession MIMAT0046677
Sequence

1 - 

aacaagcaaguucccuccacu

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).