Stem-loop sequence bta-mir-6775

AccessionMI0038398 (change log)
DescriptionBos taurus miR-6775 stem-loop
Stem-loop
   ----   -  -            a     agau 
5'     ggg ag gaacggggaccg gggag    g
       ||| || |||||||||||| |||||    g
3'     ccc uc cuugucccuggu cucuc    g
   agac   g  u            a     agac 
Get sequence
Deep sequencing
30 reads, 0 reads per million, 22 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr2: 126989447-126989509 [+]
intergenic
Database links

Mature sequence bta-miR-6775

Accession MIMAT0046673
Sequence

39 - 

cauggucccuguucucugccccaga

 - 63

Get sequence
Deep sequencing29 reads, 21 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).