Stem-loop sequence bta-mir-12005-2

AccessionMI0038391 (change log)
DescriptionBos taurus miR-12005-2 stem-loop
Stem-loop
   ---                    --g  uau 
5'    cuccccuuaaggacuucaua   aa   g
      ||||||||||||||||||||   ||    
3'    gaggggaauuccugaaguau   uu   a
   ugg                    aaa  uau 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 38431264-38431322 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-12005-2
bta-mir-12005-1chr5: 38431267-38431325 [+]
bta-mir-12005-2chr5: 38431264-38431322 [-]
Database links

Mature sequence bta-miR-12005

Accession MIMAT0046666
Sequence

38 - 

augaaguccuuaaggggagggu

 - 59

Get sequence
Deep sequencing22 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).