Stem-loop sequence bta-mir-12004

AccessionMI0038388 (change log)
DescriptionBos taurus miR-12004 stem-loop
Stem-loop
   cu               c u     u 
5'   ggcucuggcucucug c ccucc a
     ||||||||||||||| | ||||| a
3'   ccgggaccgagagac g ggagg c
   --               a -     c 
Get sequence
Deep sequencing
85 reads, 0 reads per million, 24 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr20: 31888442-31888493 [+]
intergenic
Database links

Mature sequence bta-miR-12004

Accession MIMAT0046664
Sequence

1 - 

cuggcucuggcucucugccuccu

 - 23

Get sequence
Deep sequencing18 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).