Stem-loop sequence bta-mir-12001

AccessionMI0038384 (change log)
DescriptionBos taurus miR-12001 stem-loop
Stem-loop
   --ccu       c        -    uaugg 
5'      gugaggg uucacccu ggac     a
        ||||||| |||||||| ||||      
3'      cgcuccu aaguggga ccug     g
   ccagu       -        a    ucgac 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 110461365-110461424 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-12001
bta-mir-12001chr5: 110461365-110461424 [+]
bta-mir-658chr5: 110470523-110470622 [-]
Database links

Mature sequence bta-miR-12001

Accession MIMAT0046660
Sequence

1 - 

ccugugagggcuucacccugga

 - 22

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).