Stem-loop sequence bta-mir-11999

AccessionMI0038382 (change log)
DescriptionBos taurus miR-11999 stem-loop
Stem-loop
   --    a        cuc       au uu 
5'   ucag cccauauu   auaggcc  c  a
     |||| ||||||||   |||||||  |   
3'   gguc ggguauaa   uauccgg  g  a
   au    c        -aa       cu uc 
Get sequence
Deep sequencing
169 reads, 0 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 55830756-55830814 [-]
intergenic
Database links

Mature sequence bta-miR-11999

Accession MIMAT0046658
Sequence

1 - 

ucagacccauauucucauaggc

 - 22

Get sequence
Deep sequencing168 reads, 39 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).