Stem-loop sequence bta-mir-11995

AccessionMI0038372 (change log)
DescriptionBos taurus miR-11995 stem-loop
Stem-loop
   --  g           a         acu 
5'   uu uccuacuucuc gcugucuug   c
     || ||||||||||| |||||||||   c
3'   ag aggaugaggag cgauagaac   c
   ac  g           a         aau 
Get sequence
Deep sequencing
60 reads, 0 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 2313882-2313940 [+]
intergenic
Database links

Mature sequence bta-miR-11995

Accession MIMAT0046648
Sequence

1 - 

uuguccuacuucucagcugucu

 - 22

Get sequence
Deep sequencing40 reads, 25 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).