Stem-loop sequence bta-mir-11993

AccessionMI0038358 (change log)
DescriptionBos taurus miR-11993 stem-loop
Stem-loop
   --ga      c              cc 
5'     ccugug guguacacucaugc  a
       |||||| ||||||||||||||   
3'     gggcac uacgugugaguacg  c
   ccag      c              ug 
Get sequence
Deep sequencing
20 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr6: 109289613-109289666 [-]
intergenic
Database links

Mature sequence bta-miR-11993

Accession MIMAT0046634
Sequence

1 - 

gaccugugcguguacacucaug

 - 22

Get sequence
Deep sequencing11 reads, 10 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).