Stem-loop sequence bta-mir-11992

AccessionMI0038356 (change log)
DescriptionBos taurus miR-11992 stem-loop
Stem-loop
   -ucc       u       g    --u     
5'     uagggga ugacaua ucug   guaa 
       ||||||| ||||||| ||||   ||| u
3'     gucuccu acugugu aggc   cauu 
   agau       u       a    uuc     
Get sequence
Deep sequencing
82 reads, 0 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 64348882-64348941 [-]
intergenic
Database links

Mature sequence bta-miR-11992

Accession MIMAT0046632
Sequence

1 - 

uccuaggggauugacauagucugu

 - 24

Get sequence
Deep sequencing79 reads, 37 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).