Stem-loop sequence bta-mir-11990

AccessionMI0038353 (change log)
DescriptionBos taurus miR-11990 stem-loop
Stem-loop
   --ua  -   aga     --         uug 
5'     gg cag   ugaca  gucauacug   a
       || |||   |||||  |||||||||   a
3'     cc guc   acugu  cgguaugac   u
   acaa  a   ---     ga         cgu 
Get sequence
Deep sequencing
31 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr22: 4306780-4306838 [+]
intergenic
Database links

Mature sequence bta-miR-11990

Accession MIMAT0046629
Sequence

1 - 

uaggcagagaugacagucauacu

 - 23

Get sequence
Deep sequencing31 reads, 21 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).