Stem-loop sequence bta-mir-11989

AccessionMI0038352 (change log)
DescriptionBos taurus miR-11989 stem-loop
Stem-loop
   cc        ua        ugcuga 
5'   cagggaug  gcuccuag      c
     ||||||||  ||||||||       
3'   gucccuac  cggggguc      c
   ac        -c        ucccuc 
Get sequence
Deep sequencing
79 reads, 0 reads per million, 44 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr10: 20843214-20843266 [+]
intergenic
Database links

Mature sequence bta-miR-11989

Accession MIMAT0046628
Sequence

1 - 

cccagggauguagcuccuagugc

 - 23

Get sequence
Deep sequencing78 reads, 44 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).