Stem-loop sequence bta-mir-11986b

AccessionMI0038345 (change log)
DescriptionBos taurus miR-11986b stem-loop
Stem-loop
   -                 c     g ca 
5'  uuuuccaaugaguuagu cuuug g  c
    ||||||||||||||||| ||||| |   
3'  agaagguuacucaauca gaagc u  u
   g                 a     g ag 
Get sequence
Deep sequencing
2290 reads, 19.2 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr20: 10234322-10234378 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-11986b
bta-mir-11986bchr20: 10234322-10234378 [-]
bta-mir-7858chr20: 10233343-10233401 [-]
Database links

Mature sequence bta-miR-11986b

Accession MIMAT0046621
Sequence

1 - 

uuuuccaaugaguuaguccuuu

 - 22

Get sequence
Deep sequencing2225 reads, 73 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).