Stem-loop sequence xla-mir-92a-4

AccessionMI0038339 (change log)
DescriptionXenopus laevis miR-92a-4 stem-loop
Literature search

2 open access papers mention xla-mir-92a-4
(2 sentences)

Stem-loop
   --          u   u         u cua 
5'   agguugggau ggu gcaaugcug c   u
     |||||||||| ||| ||||||||| |    
3'   uccggcccug uca cguuaugau g   u
   ug          u   -         - uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr2S: 91488294-91488353 [-]
intergenic
Clustered miRNAs
< 10kb from xla-mir-92a-4
xla-mir-17-1chr2S: 91488970-91489030 [-]
xla-mir-18bchr2S: 91488841-91488903 [-]
xla-mir-19b-2chr2S: 91488415-91488476 [-]
xla-mir-92a-4chr2S: 91488294-91488353 [-]
Database links

Mature sequence xla-miR-92a-4-5p

Accession MIMAT0046610
Sequence

1 - 

agguugggauugguugcaaugcu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence xla-miR-92a-3p

Accession MIMAT0011149
Sequence

39 - 

uauugcacuugucccggccugu

 - 60

Get sequence
Evidence by similarity; MI0003106

References

1
PMID:26548531 "Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1" Liu C, Lou CH, Shah V, Ritter R, Talley J, Soibam B, Benham A, Zhu H, Perez E, Shieh YE, Gunaratne PH, Sater AK Dev Biol. 409:26-38(2016).