![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence xla-mir-27b |
||||||||
Accession | MI0038312 (change log) | |||||||
Description | Xenopus laevis miR-27b stem-loop | |||||||
Literature search |
1 open access papers mention xla-mir-27b | |||||||
Stem-loop |
-- auug u uug 5' cagagcuuagcug gugaacag ga a ||||||||||||| |||||||| || u 3' gucuugaaucggu cacuuguu cu c ac --ga u ccu |
|||||||
Confidence |
Annotation confidence: not enough data
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence xla-miR-27b-5p |
|
Accession | MIMAT0046560 |
Sequence |
1 - cagagcuuagcugauuggugaaca - 24 |
Evidence | experimental; Illumina [1] |
Mature sequence xla-miR-27b-3p |
|
Accession | MIMAT0046561 |
Sequence |
44 - uucacaguggcuaaguucugca - 65 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:26548531
"Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1"
Dev Biol. 409:26-38(2016).
|