Stem-loop sequence xla-mir-27b

AccessionMI0038312 (change log)
DescriptionXenopus laevis miR-27b stem-loop
Literature search

1 open access papers mention xla-mir-27b
(1 sentences)

Stem-loop
   --             auug        u  uug 
5'   cagagcuuagcug    gugaacag ga   a
     |||||||||||||    |||||||| ||   u
3'   gucuugaaucggu    cacuuguu cu   c
   ac             --ga        u  ccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr1L: 125598599-125598663 [+]
intergenic
Clustered miRNAs
< 10kb from xla-mir-27b
xla-mir-23bchr1L: 125598371-125598429 [+]
xla-mir-27bchr1L: 125598599-125598663 [+]
xla-mir-24a-2chr1L: 125599057-125599115 [+]
Database links

Mature sequence xla-miR-27b-5p

Accession MIMAT0046560
Sequence

1 - 

cagagcuuagcugauuggugaaca

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence xla-miR-27b-3p

Accession MIMAT0046561
Sequence

44 - 

uucacaguggcuaaguucugca

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26548531 "Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1" Liu C, Lou CH, Shah V, Ritter R, Talley J, Soibam B, Benham A, Zhu H, Perez E, Shieh YE, Gunaratne PH, Sater AK Dev Biol. 409:26-38(2016).