Stem-loop sequence xla-mir-203

AccessionMI0038291 (change log)
DescriptionXenopus laevis miR-203 stem-loop
Literature search

1 open access papers mention xla-mir-203
(3 sentences)

Stem-loop
   --         u    g    a     c  u 
5'   agugguucu aaca uuca caguu uc a
     ||||||||| |||| |||| ||||| ||  
3'   ucaccagga uugu aagu guuaa ag u
   gu         u    a    -     -  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr8S: 10634938-10634997 [-]
intergenic
chr8L: 77739007-77739066 [+]
intergenic
Database links

Mature sequence xla-miR-203-5p

Accession MIMAT0046524
Sequence

1 - 

agugguucuuaacaguucaacag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence xla-miR-203-3p

Accession MIMAT0046525
Sequence

39 - 

gugaaauguuuaggaccacuug

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26548531 "Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1" Liu C, Lou CH, Shah V, Ritter R, Talley J, Soibam B, Benham A, Zhu H, Perez E, Shieh YE, Gunaratne PH, Sater AK Dev Biol. 409:26-38(2016).