Stem-loop sequence xla-mir-124-1

AccessionMI0038237 (change log)
DescriptionXenopus laevis miR-124-1 stem-loop
Literature search

1 open access papers mention xla-mir-124-1
(1 sentences)

Stem-loop
   -c        a   ga        uaaau 
5'   guguucac gcg  ccuugauu     g
     |||||||| |||  ||||||||     u
3'   cguaagug cgc  ggaauuaa     c
   ac        g   ac        cauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr5S: 132473097-132473156 [+]
intergenic
chr5L: 153450354-153450413 [+]
intergenic
Database links

Mature sequence xla-miR-124-5p

Accession MIMAT0046430
Sequence

1 - 

cguguucacagcggaccuugau

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence xla-miR-124-3p

Accession MIMAT0046429
Sequence

40 - 

uaaggcacgcggugaaugcca

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26548531 "Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1" Liu C, Lou CH, Shah V, Ritter R, Talley J, Soibam B, Benham A, Zhu H, Perez E, Shieh YE, Gunaratne PH, Sater AK Dev Biol. 409:26-38(2016).