Stem-loop sequence pte-mir-11968-1

AccessionMI0038155 (change log)
DescriptionParasteatoda tepidariorum miR-11968-1 stem-loop
Stem-loop
        c    --     c      -u   uau 
5' aggga auug  acuag aagcug  ugu   g
   ||||| ||||  ||||| ||||||  |||    
3' ucccu ugau  ugguc uucgac  aua   u
        c    aa     u      cc   uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_75: 1317191-1317253 [-]
intergenic
Database links

Mature sequence pte-miR-11968-5p

Accession MIMAT0046330
Sequence

1 - 

agggacauugacuagcaagcug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11968-3p

Accession MIMAT0046331
Sequence

42 - 

gcuuucugguaauagucucccu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).