Stem-loop sequence pte-mir-11967

AccessionMI0038154 (change log)
DescriptionParasteatoda tepidariorum miR-11967 stem-loop
Stem-loop
   --a  u      -  a         uugu 
5'    ga gcugcg cu ugaguuauu    u
      || |||||| || |||||||||    u
3'    cu cgaugc ga acucaauaa    u
   ugg  u      u  a         uaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_2892.1: 209561-209618 [+]
intergenic
Database links

Mature sequence pte-miR-11967-5p

Accession MIMAT0046328
Sequence

1 - 

agaugcugcgcuaugaguuauu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11967-3p

Accession MIMAT0046329
Sequence

36 - 

uaacucaaagucguagcuucggu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).