Stem-loop sequence pte-mir-11966

AccessionMI0038153 (change log)
DescriptionParasteatoda tepidariorum miR-11966 stem-loop
Stem-loop
   -                        u   a 
5'  cccaaccuaauauuuauuucugag uca a
    |||||||||||||||||||||||| ||| a
3'  ggguuggguuauaaauaaagacuc agu a
   u                        u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_465: 3479204-3479265 [+]
intergenic
Database links

Mature sequence pte-miR-11966-5p

Accession MIMAT0046326
Sequence

1 - 

cccaaccuaauauuuauuucug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11966-3p

Accession MIMAT0046327
Sequence

41 - 

agaaauaaauauuggguugggu

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).