Stem-loop sequence pte-mir-11947b-1

AccessionMI0038134 (change log)
DescriptionParasteatoda tepidariorum miR-11947b-1 stem-loop
Stem-loop
   ----         g          -   gu 
5'     acauuccua cauguugguu agc  c
       ||||||||| |||||||||| |||   
3'     uguaaggau guacgacuaa ucg  u
   uuua         g          a   au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_40: 1005220-1005276 [+]
intergenic
Database links

Mature sequence pte-miR-11947b-5p

Accession MIMAT0046296
Sequence

1 - 

acauuccuagcauguugguua

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11947b-3p

Accession MIMAT0046297
Sequence

36 - 

ucagcaugguaggaauguauuu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).