Stem-loop sequence pte-mir-11956

AccessionMI0038133 (change log)
DescriptionParasteatoda tepidariorum miR-11956 stem-loop
Stem-loop
   --                                  a 
5'   agcucauugagcuaaacagaaacaguucauaaga u
     ||||||||||||||||||||||||||||||||||  
3'   ucgaguaauucgauuugucuuugucaaguauucu c
   uc                                  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_268: 537859-537932 [-]
intergenic
Database links

Mature sequence pte-miR-11956-5p

Accession MIMAT0046294
Sequence

1 - 

agcucauugagcuaaacagaaa

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11956-3p

Accession MIMAT0046295
Sequence

53 - 

ucuguuuagcuuaaugagcucu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).