Stem-loop sequence pte-mir-11952

AccessionMI0038128 (change log)
DescriptionParasteatoda tepidariorum miR-11952 stem-loop
Stem-loop
   --          -   ug    c   u    a 
5'   gcaauaucgg guu  aacg ugc ugcu g
     |||||||||| |||  |||| ||| |||| a
3'   cguuauagcc caa  uugc aug guga u
   cc          a   --    a   u    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_230: 1499973-1500034 [+]
intergenic
Database links

Mature sequence pte-miR-11952-5p

Accession MIMAT0046284
Sequence

1 - 

gcaauaucggguuugaacgcugc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11952-3p

Accession MIMAT0046285
Sequence

41 - 

aacguuaacaccgauauugccc

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).