Stem-loop sequence pte-mir-11950

AccessionMI0038125 (change log)
DescriptionParasteatoda tepidariorum miR-11950 stem-loop
Stem-loop
   --    a   cu      ca     uuau 
5'   aggc aag  ccucuu  guaaa    c
     |||| |||  ||||||  |||||     
3'   uucg uuc  ggaggg  cauuu    a
   aa    g   au      -c     uagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_786: 6403352-6403408 [-]
intergenic
Clustered miRNAs
< 10kb from pte-mir-11950
pte-mir-35zScf5bK3_786: 6406386-6406445 [-]
pte-mir-35iScf5bK3_786: 6405550-6405606 [-]
pte-mir-35fScf5bK3_786: 6405166-6405222 [-]
pte-mir-11950Scf5bK3_786: 6403352-6403408 [-]
pte-mir-35cScf5bK3_786: 6403218-6403274 [-]
pte-mir-35hScf5bK3_786: 6403027-6403083 [-]
pte-mir-35gScf5bK3_786: 6402613-6402671 [-]
pte-mir-35dScf5bK3_786: 6402310-6402366 [-]
pte-mir-35aScf5bK3_786: 6401680-6401736 [-]
pte-mir-35bScf5bK3_786: 6400546-6400602 [-]
Database links

Mature sequence pte-miR-11950-5p

Accession MIMAT0046278
Sequence

1 - 

aggcaaagcuccucuucaguaaa

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11950-3p

Accession MIMAT0046279
Sequence

36 - 

uaccgggagguacuuggcuuaa

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).