Stem-loop sequence pte-mir-11948

AccessionMI0038123 (change log)
DescriptionParasteatoda tepidariorum miR-11948 stem-loop
Stem-loop
   --          -   a       gg   au 
5'   uauacgacuu uuc acaacuu  uug  a
     |||||||||| ||| |||||||  |||   
3'   auaugcugaa aag uguugaa  aac  a
   ug          c   c       --   gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_332: 2190701-2190759 [+]
intergenic
Database links

Mature sequence pte-miR-11948-5p

Accession MIMAT0046274
Sequence

1 - 

uauacgacuuuucaacaacuu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11948-3p

Accession MIMAT0046275
Sequence

38 - 

guugucgaacaagucguauagu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).