Stem-loop sequence pte-mir-11947a-2

AccessionMI0038122 (change log)
DescriptionParasteatoda tepidariorum miR-11947a-2 stem-loop
Stem-loop
   --                      -    u 
5'   auguguucauagucuguuaguu agcg c
     |||||||||||||||||||||| ||||  
3'   uacacaaguaucagacaauuaa ucgc u
   uu                      a    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_1054: 3732459-3732517 [-]
intergenic
Database links

Mature sequence pte-miR-11947a-5p

Accession MIMAT0046272
Sequence

1 - 

auguguucauagucuguuaguua

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11947a-3p

Accession MIMAT0046273
Sequence

38 - 

uuaacagacuaugaacacauuu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).