Stem-loop sequence pte-mir-11944

AccessionMI0038118 (change log)
DescriptionParasteatoda tepidariorum miR-11944 stem-loop
Stem-loop
   --  u     u                cuu 
5'   cc cgaac cuacauggcgccaaua   u
     || ||||| ||||||||||||||||    
3'   gg gcuug gauguaccgcgguuau   c
   ca  c     u                aga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_265: 5658206-5658265 [+]
intergenic
Database links

Mature sequence pte-miR-11944-5p

Accession MIMAT0046266
Sequence

1 - 

ccucgaacucuacauggcgcca

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11944-3p

Accession MIMAT0046267
Sequence

38 - 

ggcgccauguaguguucgcggac

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).