Stem-loop sequence pte-mir-11943

AccessionMI0038116 (change log)
DescriptionParasteatoda tepidariorum miR-11943 stem-loop
Stem-loop
   uu   -----     a     c   uuuaau 
5'   gca     aagug aucgu agc      c
     |||     ||||| ||||| |||      u
3'   cgu     uucau uggua uug      c
   -u   agaac     g     -   uuugaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_15205: 103124-103181 [-]
intergenic
Database links

Mature sequence pte-miR-11943-5p

Accession MIMAT0046262
Sequence

1 - 

uugcaaagugaaucgucagcuu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11943-3p

Accession MIMAT0046263
Sequence

37 - 

uuaugguguacuucaagaugcu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).