Stem-loop sequence pte-mir-92b-2

AccessionMI0038103 (change log)
DescriptionParasteatoda tepidariorum miR-92b-2 stem-loop
Stem-loop
   -            cug        -   cu 
5'  aggucgggauga   gcaguauu guu  u
    ||||||||||||   |||||||| |||   
3'  uccggcccugcu   cguuauaa caa  u
   a            -ca        u   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_2782: 255811-255869 [-]
intergenic
Database links

Mature sequence pte-miR-92b-5p

Accession MIMAT0046235
Sequence

1 - 

aggucgggaugacuggcaguauu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-92b-3p

Accession MIMAT0046236
Sequence

39 - 

uauugcacucgucccggccua

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).