Stem-loop sequence pte-mir-92c

AccessionMI0038102 (change log)
DescriptionParasteatoda tepidariorum miR-92c stem-loop
Stem-loop
   --     a   ug    g       ----  uau 
5'   agauc gga  agug caauauu    gc   a
     ||||| |||  |||| |||||||    ||    
3'   ucugg ccu  ucac guuauaa    cg   u
   ag     c   gu    -       gcac  uag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_50: 6409767-6409829 [+]
intergenic
Database links

Mature sequence pte-miR-92c-5p

Accession MIMAT0046237
Sequence

1 - 

agaucaggaugaguggcaauauu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-92c-3p

Accession MIMAT0046238
Sequence

42 - 

uauugcacuugucccggucuga

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).