Stem-loop sequence pte-mir-92b-1

AccessionMI0038101 (change log)
DescriptionParasteatoda tepidariorum miR-92b-1 stem-loop
Stem-loop
   -            cug            cu 
5'  aggucgggauga   gcaguauuuguu  a
    ||||||||||||   ||||||||||||   
3'  uccggcccugcu   cguuauaagcaa  u
   a            -ca            cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_2017: 1656729-1656788 [-]
intergenic
Database links

Mature sequence pte-miR-92b-5p

Accession MIMAT0046235
Sequence

1 - 

aggucgggaugacuggcaguauu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-92b-3p

Accession MIMAT0046236
Sequence

40 - 

uauugcacucgucccggccua

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).