Stem-loop sequence pte-mir-87b

AccessionMI0038097 (change log)
DescriptionParasteatoda tepidariorum miR-87b stem-loop
Stem-loop
   --ca   c     c   u      aug   ugu 
5'     gcc ggagc uug cucaac   uga   a
       ||| ||||| ||| ||||||   |||    
3'     cgg cuuug aac gaguug   acu   g
   uaag   a     a   -      ---   uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_2865: 1396007-1396068 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-87b
pte-mir-87bScf5bK3_2865: 1396007-1396068 [+]
pte-mir-87aScf5bK3_2865: 1396953-1397013 [+]
Database links

Mature sequence pte-miR-87b-5p

Accession MIMAT0046227
Sequence

1 - 

cagcccggagccuugucucaac

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-87b-3p

Accession MIMAT0046228
Sequence

41 - 

uugagcaaaguuucaggcgaau

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).