Stem-loop sequence pte-mir-745

AccessionMI0038094 (change log)
DescriptionParasteatoda tepidariorum miR-745 stem-loop
Stem-loop
   --     a    c    u   a  uu  u 
5'   agucc ucau gggu gcu gc  uu u
     ||||| |||| |||| ||| ||  || u
3'   ucggg agug cccg cga cg  aa a
   ug     a    u    u   c  uu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_603: 1331700-1331758 [-]
intergenic
Database links

Mature sequence pte-miR-745-5p

Accession MIMAT0046221
Sequence

1 - 

aguccaucaucggguugcuagc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-745-3p

Accession MIMAT0046222
Sequence

38 - 

cagcugcccugugaagggcugu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).